ROUGE

Gene/Protein Characteristic Table for mKIAA0122

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122208
Description :	RNA binding motif protein 10.
Clone Name :	mbg05536 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5111 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 201 bp

Genome contig ID gi66880665f_18756782
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AATCATGTTCCTTTTGTAATAAAATCTAAAAAGCC
Flanking genome sequence
(133046 - 133095)
----+----*----+----*----+----*----+----*----+----*
TGCATCTTCCATTTCTACTTTCTCATGTCCTAGTATGGTTTCTTACACAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0122 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0122	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 321..767, 2607..3023, 3192..4910
Length: 860 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL00746	99.7	RNA binding mot...	Mus musculus
BAC40753	99.6	unnamed protein...	Mus musculus
BAE39715	99.5	unnamed protein...	Mus musculus
P70501	97.8	RNA-binding pro...	Rattus norvegicus
CAI41700	95.6	RNA binding mot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220446	4.9e-14	26.1	mKIAA4015

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001876 140 171 PF00641 Zinc finger

IPR000467 788 832 PF01585 D111/G-patch

HMMSmart IPR000504 65 133 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

IPR001876 143 168 SM00547 Zinc finger

IPR000504 230 310 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

IPR000467 786 832 SM00443 D111/G-patch

ProfileScan IPR000504 42 137 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

IPR001876 140 171 PS50199 Zinc finger

IPR000504 229 314 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

NULL 491 537 PS50328 NULL

IPR007087 689 719 PS50157 Zinc finger

IPR000467 788 834 PS50174 D111/G-patch

ScanRegExp IPR001876 145 165 PS01358 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001876	140	171	PF00641	Zinc finger
IPR000467	788	832	PF01585	D111/G-patch
HMMSmart	IPR000504	65	133	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
IPR001876	143	168	SM00547	Zinc finger
IPR000504	230	310	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
IPR000467	786	832	SM00443	D111/G-patch
ProfileScan	IPR000504	42	137	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
IPR001876	140	171	PS50199	Zinc finger
IPR000504	229	314	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
NULL	491	537	PS50328	NULL
IPR007087	689	719	PS50157	Zinc finger
IPR000467	788	834	PS50174	D111/G-patch
ScanRegExp	IPR001876	145	165	PS01358	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	201 bp
Genome contig ID	gi66880665f_18756782
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATCATGTTCCTTTTGTAATAAAATCTAAAAAGCC
Flanking genome sequence (133046 - 133095)	----+--------+--------+--------+--------+----* TGCATCTTCCATTTCTACTTTCTCATGTCCTAGTATGGTTTCTTACACAG

Gene/Protein Characteristic Table for mKIAA0122

Features of the cloned DNA sequence

Features of the protein sequence