ROUGE

Gene/Protein Characteristic Table for mKIAA2000

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173327
Description :
Clone Name :	mic17043 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 5392 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1598 bp

Genome contig ID gi65519420f_103880443
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
AAAAAATGTATGTTTTAAAATAAAAGTGTAATTGC
Flanking genome sequence
(140767 - 140816)
----+----*----+----*----+----*----+----*----+----*
AAGTTCTCTCATTTTGCAGTCTGTATTAGAGGGCTATTTTGCATAGTTAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2000 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2000	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3794
Length: 1263 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_082997	100.0	nephrocystin 3 ...	Mus musculus
Q7TNH6	99.3	Nephrocystin-3.	Mus musculus
XP_343462	94.9	similar to neph...	Rattus norvegicus
AAI15725	99.2	Nphp3 protein [...	Mus musculus
Q7Z494	88.8	Nephrocystin-3.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093256	9.3e-07	24.2	mKIAA0664
AK122222	0.00041	25.5	mKIAA0228

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001440 876 909 PF00515 TPR repeat

IPR011716 918 951 PF07720 Tetratricopeptide TPR_3

IPR001440 918 951 PF00515 TPR repeat

IPR011716 960 993 PF07720 Tetratricopeptide TPR_3

IPR001440 960 993 PF00515 TPR repeat

IPR001440 1026 1059 PF00515 TPR repeat

NULL 1026 1059 PF07719 NULL

IPR011716 1068 1101 PF07720 Tetratricopeptide TPR_3

IPR001440 1068 1101 PF00515 TPR repeat

NULL 1068 1101 PF07719 NULL

IPR011716 1109 1143 PF07720 Tetratricopeptide TPR_3

IPR001440 1110 1143 PF00515 TPR repeat

IPR001440 1152 1185 PF00515 TPR repeat

NULL 1152 1185 PF07719 NULL

IPR011716 1194 1227 PF07720 Tetratricopeptide TPR_3

IPR001440 1194 1227 PF00515 TPR repeat

NULL 1194 1227 PF07719 NULL

HMMSmart IPR001440 876 909 SM00028 TPR repeat

IPR001440 918 951 SM00028 TPR repeat

IPR001440 960 993 SM00028 TPR repeat

IPR001440 1026 1059 SM00028 TPR repeat

IPR001440 1068 1101 SM00028 TPR repeat

IPR001440 1110 1143 SM00028 TPR repeat

IPR001440 1152 1185 SM00028 TPR repeat

IPR001440 1194 1227 SM00028 TPR repeat

ProfileScan IPR001440 876 1227 PS50293 TPR repeat

IPR001440 876 909 PS50005 TPR repeat

IPR001440 918 951 PS50005 TPR repeat

IPR001440 1026 1059 PS50005 TPR repeat

IPR001440 1068 1101 PS50005 TPR repeat

IPR001440 1110 1143 PS50005 TPR repeat

IPR001440 1152 1185 PS50005 TPR repeat

IPR001440 1194 1227 PS50005 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	876	909	PF00515	TPR repeat
IPR011716	918	951	PF07720	Tetratricopeptide TPR_3
IPR001440	918	951	PF00515	TPR repeat
IPR011716	960	993	PF07720	Tetratricopeptide TPR_3
IPR001440	960	993	PF00515	TPR repeat
IPR001440	1026	1059	PF00515	TPR repeat
NULL	1026	1059	PF07719	NULL
IPR011716	1068	1101	PF07720	Tetratricopeptide TPR_3
IPR001440	1068	1101	PF00515	TPR repeat
NULL	1068	1101	PF07719	NULL
IPR011716	1109	1143	PF07720	Tetratricopeptide TPR_3
IPR001440	1110	1143	PF00515	TPR repeat
IPR001440	1152	1185	PF00515	TPR repeat
NULL	1152	1185	PF07719	NULL
IPR011716	1194	1227	PF07720	Tetratricopeptide TPR_3
IPR001440	1194	1227	PF00515	TPR repeat
NULL	1194	1227	PF07719	NULL
HMMSmart	IPR001440	876	909	SM00028	TPR repeat
IPR001440	918	951	SM00028	TPR repeat
IPR001440	960	993	SM00028	TPR repeat
IPR001440	1026	1059	SM00028	TPR repeat
IPR001440	1068	1101	SM00028	TPR repeat
IPR001440	1110	1143	SM00028	TPR repeat
IPR001440	1152	1185	SM00028	TPR repeat
IPR001440	1194	1227	SM00028	TPR repeat
ProfileScan	IPR001440	876	1227	PS50293	TPR repeat
IPR001440	876	909	PS50005	TPR repeat
IPR001440	918	951	PS50005	TPR repeat
IPR001440	1026	1059	PS50005	TPR repeat
IPR001440	1068	1101	PS50005	TPR repeat
IPR001440	1110	1143	PS50005	TPR repeat
IPR001440	1152	1185	PS50005	TPR repeat
IPR001440	1194	1227	PS50005	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1598 bp
Genome contig ID	gi65519420f_103880443
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AAAAAATGTATGTTTTAAAATAAAAGTGTAATTGC
Flanking genome sequence (140767 - 140816)	----+--------+--------+--------+--------+----* AAGTTCTCTCATTTTGCAGTCTGTATTAGAGGGCTATTTTGCATAGTTAT

Gene/Protein Characteristic Table for mKIAA2000

Features of the cloned DNA sequence

Features of the protein sequence