ROUGE

Gene/Protein Characteristic Table for mKIAA0664

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093256
Description :
Clone Name :	mbg01465 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5056 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2775 bp

Genome contig ID gi65527427f_74282877
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GTCTTCATTTCACATTGGAATAAAGTGAGTTTTTG
Flanking genome sequence
(113623 - 113672)
----+----*----+----*----+----*----+----*----+----*
AAACCTGCTGCCCCAGCCTTTCCTGTGTGCTCTGTGGAACTTGTTCCTAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0664 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0664	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2257, 2370..3827
Length: 1237 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE34042	100.0	unnamed protein...	Mus musculus
EDL12775	99.4	mCG1339 [Mus mu...	Mus musculus
CAI24374	99.8	novel protein [...	Mus musculus
BAE20503	99.8	unnamed protein...	Mus musculus
XP_220693	97.9	similar to Puta...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173327	6e-08	24.2	mKIAA2000

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR002086 754 761 PS00687 Aldehyde dehydrogenase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR002086	754	761	PS00687	Aldehyde dehydrogenase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2775 bp
Genome contig ID	gi65527427f_74282877
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GTCTTCATTTCACATTGGAATAAAGTGAGTTTTTG
Flanking genome sequence (113623 - 113672)	----+--------+--------+--------+--------+----* AAACCTGCTGCCCCAGCCTTTCCTGTGTGCTCTGTGGAACTTGTTCCTAT

Gene/Protein Characteristic Table for mKIAA0664

Features of the cloned DNA sequence

Features of the protein sequence