Gene/Protein Characteristic Table for mKIAA1891

Length: 4644 bp

Restriction map

Length of 3'UTR	1089 bp
Genome contig ID	gi65515060r_80092738
PolyA signal sequence (ATTAAA,-23)	+----*----+----*----+----*----+---- GCTTCATGAAATATTAAAATGCCACACCTCACTTC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* CCTACTGTCCTGTTTTGGTTTTCCTTTTTGATCCTGGGGTGTTTGCTATT

KIAA	Alignment based on:
KIAA1891	DNA sequence, AA sequence, Physical map

Coding region: 295..3555

Length: 1086 aa

Entry Exp ID% Protein Source Q8BW70 0 99.7 Ubiquitin carbo... Mus musculus BAC34890 0 99.6 unnamed protein... Mus musculus BAC35661 0 99.6 unnamed protein... Mus musculus XP_001092815 0 90.8 similar to ubiq... Macaca mulatta Q8NB14 0 90.0 Ubiquitin carbo... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220266 5.4e-26 60.6 mKIAA1372 AK122442 6.9e-06 25.9 mKIAA1097 AK173083 3.2e-05 24.3 mKIAA1003 AK173210 0.00015 28.3 mKIAA1594 AK220190 0.00036 26.2 mKIAA4202

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	486	990	PF00443	Peptidase C19
ProfileScan	IPR001394	489	994	PS50235	Peptidase C19
ScanRegExp	IPR001394	490	505	PS00972	Peptidase C19
	IPR001394	884	902	PS00973	Peptidase C19

Method	From	To	amino acid sequence
SOSUI	336	358	ALLKGLAAVQKFTILIDVTLLKI