ROUGE

Gene/Protein Characteristic Table for mKIAA4202

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220190
Description :
Clone Name :	mpj00623 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2288 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 678 bp

Genome contig ID gi65493515f_136375490
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTGTTCCCTAAGAGTGGCATATATGTGTACAATTT
Flanking genome sequence
(122963 - 123012)
----+----*----+----*----+----*----+----*----+----*
TTAAAAAAAGATTGATTTATTTATTTTATGTATATGAGTACACTGTAGCT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 48..1607
Length: 520 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE21579	0	100.0	unnamed protein...	Mus musculus
BAE38603	2e-213	99.8	unnamed protein...	Mus musculus
Q3V0C5	4.1e-213	100.0	Ubiquitin carbo...	Mus musculus
CAM19412	1.8e-212	99.8	ubiquitin speci...	Mus musculus
CAM19413	2.6e-212	99.8	ubiquitin speci...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129363	5.5e-16	27.0	mKIAA1453
AK122195	7.5e-14	25.6	mKIAA0055
AK173083	4.5e-12	33.3	mKIAA1003
AK122301	2.7e-11	36.4	mKIAA0529
AK122442	1.5e-08	29.3	mKIAA1097

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 122 453 PF00443 Peptidase C19

ProfileScan IPR001394 125 457 PS50235 Peptidase C19

ScanRegExp IPR001394 372 390 PS00973 Peptidase C19

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	122	453	PF00443	Peptidase C19
ProfileScan	IPR001394	125	457	PS50235	Peptidase C19
ScanRegExp	IPR001394	372	390	PS00973	Peptidase C19

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	678 bp
Genome contig ID	gi65493515f_136375490
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGTTCCCTAAGAGTGGCATATATGTGTACAATTT
Flanking genome sequence (122963 - 123012)	----+--------+--------+--------+--------+----* TTAAAAAAAGATTGATTTATTTATTTTATGTATATGAGTACACTGTAGCT

Gene/Protein Characteristic Table for mKIAA4202

Features of the cloned DNA sequence

Features of the protein sequence