ROUGE

Gene/Protein Characteristic Table for mKIAA1878

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK082709
Description :	microtubule-associated protein 6.
Clone Name :	mfj00027 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4035 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3099 bp

Genome contig ID gi65511124f_93258639
PolyA signal sequence
(GATAAA,-30)
+----*----+----*----+----*----+----
GTATAGATAAAAAAATGTCTGGGATGTATAGACCT
Flanking genome sequence
(104036 - 104085)
----+----*----+----*----+----*----+----*----+----*
ATTTGGAACATTGTTTTTTTCCCCTCCCCTATTGTCTGACTTTCTTTTCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1878 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1878	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..936
Length: 311 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH53039	4.1e-102	100.0	Microtubule-ass...	Mus musculus
Q7TSJ2	5.8e-102	100.0	Microtubule-ass...	Mus musculus
CAA75930	1e-101	99.7	neuronal-STOP p...	Mus musculus
CAA75049	1.5e-101	99.7	STOP protein [M...	Mus musculus
Q63560	3.3e-88	84.6	Microtubule-ass...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007882 1 311 PF05217 STOP

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007882	1	311	PF05217	STOP

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3099 bp
Genome contig ID	gi65511124f_93258639
PolyA signal sequence (GATAAA,-30)	+--------+--------+----*----+---- GTATAGATAAAAAAATGTCTGGGATGTATAGACCT
Flanking genome sequence (104036 - 104085)	----+--------+--------+--------+--------+----* ATTTGGAACATTGTTTTTTTCCCCTCCCCTATTGTCTGACTTTCTTTTCC

Gene/Protein Characteristic Table for mKIAA1878

Features of the cloned DNA sequence

Features of the protein sequence