Gene/Protein Characteristic Table for mKIAA0067

Length: 5124 bp

Restriction map

Length of 3'UTR	3283 bp
Genome contig ID	gi65492966r_94711374
PolyA signal sequence (ATTAAA,-19)	+----*----+----*----+----*----+---- CCTTTAATATACTTTAATTAAAAAAAATTAACAGT
Flanking genome sequence (99984 - 99935)	----+----*----+----*----+----*----+----*----+----* ACATTTTGGTCTGAAATGGTCCCTCGCCGAAATATCAGGTCCTACCTGTA

KIAA	Alignment based on:
KIAA0067	DNA sequence, AA sequence, Physical map

Coding region: 3..1838, 2925..4577

Length: 1162 aa

Entry Exp ID% Protein Source EDL38808 0 99.8 mCG16729, isofo... Mus musculus AAO73535 0 99.7 SET domain ERG-... Mus musculus EDL38807 0 99.7 mCG16729, isofo... Mus musculus O88974 0 99.6 Histone-lysine ... Mus musculus XP_001060316 0 94.0 similar to SET ... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129461 0.00087 35.4 mKIAA1876

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001739	468	542	PF01429	Methyl-CpG binding
	IPR007728	555	667	PF05033	Pre-SET
	IPR001214	669	1144	PF00856	Nuclear protein SET
HMMSmart	IPR002999	112	174	SM00333	Tudor
	IPR002999	202	257	SM00333	Tudor
	IPR001739	471	546	SM00391	Methyl-CpG binding
	IPR003606	553	658	SM00468	Nuclear protein Zn2+-binding
	IPR001214	675	1143	SM00317	Nuclear protein SET
ProfileScan	IPR000694	393	423	PS50099	Proline-rich region
	IPR001214	686	1141	PS50280	Nuclear protein SET

Method	From	To	amino acid sequence
-	-	-	-