ROUGE |
Gene/Protein Characteristic Table for mKIAA0067 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122198 |
---|---|
Histone-lysine N-methyltransferase, H3 lysine-9 specific 4. | |
mbg05662 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5124 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3283 bp Genome contig ID gi65492966r_94711374 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
CCTTTAATATACTTTAATTAAAAAAAATTAACAGTFlanking genome sequence
(99984 - 99935) ----+----*----+----*----+----*----+----*----+----*
ACATTTTGGTCTGAAATGGTCCCTCGCCGAAATATCAGGTCCTACCTGTA
KIAA Alignment based on: KIAA0067 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1838, 2925..4577
Length: 1162 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001739 | 468 | 542 | PF01429 | Methyl-CpG binding |
IPR007728 | 555 | 667 | PF05033 | Pre-SET | |
IPR001214 | 669 | 1144 | PF00856 | Nuclear protein SET | |
HMMSmart | IPR002999 | 112 | 174 | SM00333 | Tudor |
IPR002999 | 202 | 257 | SM00333 | Tudor | |
IPR001739 | 471 | 546 | SM00391 | Methyl-CpG binding | |
IPR003606 | 553 | 658 | SM00468 | Nuclear protein Zn2+-binding | |
IPR001214 | 675 | 1143 | SM00317 | Nuclear protein SET | |
ProfileScan | IPR000694 | 393 | 423 | PS50099 | Proline-rich region |
IPR001214 | 686 | 1141 | PS50280 | Nuclear protein SET |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |