ROUGE |
Gene/Protein Characteristic Table for mKIAA1851 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129456 |
---|---|
GDP-mannose pyrophosphorylase B. | |
mpg00887 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4811 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 792 bp Genome contig ID gi65519420f_108018550 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
GCTATGACATTTTGTAATAAAAGTGGTACATGATCFlanking genome sequence
(105138 - 105187) ----+----*----+----*----+----*----+----*----+----*
ATCGCTGGGCCTTCCCAGATGGATCCCCTTGTGTGCTCAGCTCTTGATCC
KIAA Alignment based on: KIAA1851 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..567, 2469..4019
Length: 705 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |