ROUGE

Gene/Protein Characteristic Table for mKIAA0416

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122278
Description :	leucine-rich repeat transmembrane neuronal 2 protein.
Clone Name :	mbg05717 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5650 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3688 bp

Genome contig ID gi65551972r_35332670
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
CAGAAAAGTTTTGTTATTAAAATTGTGTATACTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAACCCGAATGTCTCCTTTGTTTATAATTTTCTCCTGAAACCTGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0416 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0416	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 376..1962
Length: 528 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8BGA3	100.0	Leucine-rich re...	Mus musculus
BAC32862	99.8	unnamed protein...	Mus musculus
EDL76254	99.2	rCG49309 [Rattu...	Rattus norvegicus
AAI46062	98.3	LRRTM2 protein ...	Bos taurus
XP_538650	98.5	similar to Leuc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220290	2.7e-21	35.8	mKIAA4111
AK122338	1.8e-19	32.6	mKIAA0644
AK032467	2.4e-15	24.9	mKIAA1580
AK220505	9.2e-15	32.3	mKIAA4141
AK122376	1.2e-14	32.4	mKIAA0813

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 148 161 PR00019 Leucine-rich repeat

IPR001611 193 206 PR00019 Leucine-rich repeat

HMMPfam IPR001611 99 122 PF00560 Leucine-rich repeat

IPR001611 123 146 PF00560 Leucine-rich repeat

IPR001611 147 170 PF00560 Leucine-rich repeat

IPR001611 171 194 PF00560 Leucine-rich repeat

IPR001611 195 218 PF00560 Leucine-rich repeat

IPR001611 219 242 PF00560 Leucine-rich repeat

IPR001611 267 290 PF00560 Leucine-rich repeat

IPR001611 291 314 PF00560 Leucine-rich repeat

HMMSmart NULL 97 119 SM00366 NULL

IPR003591 97 120 SM00369 Leucine-rich repeat

IPR003591 121 144 SM00369 Leucine-rich repeat

NULL 145 167 SM00366 NULL

IPR003591 145 168 SM00369 Leucine-rich repeat

NULL 169 191 SM00366 NULL

IPR003591 169 192 SM00369 Leucine-rich repeat

NULL 193 216 SM00366 NULL

IPR003591 193 216 SM00369 Leucine-rich repeat

NULL 217 239 SM00366 NULL

IPR003591 217 237 SM00369 Leucine-rich repeat

IPR003591 241 264 SM00369 Leucine-rich repeat

IPR003591 265 288 SM00369 Leucine-rich repeat

NULL 289 311 SM00366 NULL

IPR003591 289 312 SM00369 Leucine-rich repeat

ProfileScan IPR003591 106 177 PS50506 Leucine-rich repeat

IPR003591 178 249 PS50506 Leucine-rich repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	148	161	PR00019	Leucine-rich repeat
IPR001611	193	206	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	99	122	PF00560	Leucine-rich repeat
IPR001611	123	146	PF00560	Leucine-rich repeat
IPR001611	147	170	PF00560	Leucine-rich repeat
IPR001611	171	194	PF00560	Leucine-rich repeat
IPR001611	195	218	PF00560	Leucine-rich repeat
IPR001611	219	242	PF00560	Leucine-rich repeat
IPR001611	267	290	PF00560	Leucine-rich repeat
IPR001611	291	314	PF00560	Leucine-rich repeat
HMMSmart	NULL	97	119	SM00366	NULL
IPR003591	97	120	SM00369	Leucine-rich repeat
IPR003591	121	144	SM00369	Leucine-rich repeat
NULL	145	167	SM00366	NULL
IPR003591	145	168	SM00369	Leucine-rich repeat
NULL	169	191	SM00366	NULL
IPR003591	169	192	SM00369	Leucine-rich repeat
NULL	193	216	SM00366	NULL
IPR003591	193	216	SM00369	Leucine-rich repeat
NULL	217	239	SM00366	NULL
IPR003591	217	237	SM00369	Leucine-rich repeat
IPR003591	241	264	SM00369	Leucine-rich repeat
IPR003591	265	288	SM00369	Leucine-rich repeat
NULL	289	311	SM00366	NULL
IPR003591	289	312	SM00369	Leucine-rich repeat
ProfileScan	IPR003591	106	177	PS50506	Leucine-rich repeat
IPR003591	178	249	PS50506	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 25 47 PMLAAIYAMSVVLKMLPALGMAC

435 456 VITGTMALLFSFFFIIFIVFIS

Method	From	To	amino acid sequence
SOSUI	25	47	PMLAAIYAMSVVLKMLPALGMAC
435	456	VITGTMALLFSFFFIIFIVFIS

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3688 bp
Genome contig ID	gi65551972r_35332670
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CAGAAAAGTTTTGTTATTAAAATTGTGTATACTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAACCCGAATGTCTCCTTTGTTTATAATTTTCTCCTGAAACCTGC

Gene/Protein Characteristic Table for mKIAA0416

Features of the cloned DNA sequence

Features of the protein sequence