ROUGE |
Gene/Protein Characteristic Table for mKIAA1848 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129455 |
---|---|
SH3 domain GRB2-like protein B2. | |
mbj00047 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3186 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2379 bp Genome contig ID gi66880554r_30176974 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TGCTTGCTCTCTGGCAAATAAATCCTTTGTGTGCGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATCAGGATCTCAGTCCATGAGCCACCCTGAAAGTGGATGGAAGACTTCA
KIAA Alignment based on: KIAA1848 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1..672, 2123..2677
Length: 408 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |