ROUGE

Gene/Protein Characteristic Table for mKIAA1844

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173274
Description :	WW domain-containing protein 4.
Clone Name :	mia34065 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 3092 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1380 bp

Genome contig ID gi65551972f_7812135
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TATATTAAAATAAAAAAAGAAACGATTGCTACTAT
Flanking genome sequence
(157957 - 158006)
----+----*----+----*----+----*----+----*----+----*
AAAGCTACCTTGGCTTTTTTTTTTTTAACCCGTTTGCTTAAAAATTTTAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1844 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1844	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1712
Length: 569 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL23017	1.7e-158	99.2	WW domain conta...	Mus musculus
EAW86035	2.2e-156	94.7	WW domain conta...	Homo sapiens
XP_001064372	3e-155	97.3	similar to WW d...	Rattus norvegicus
XP_001473520	1.5e-147	99.2	similar to WW d...	Mus musculus
CAH90012	3.3e-141	94.4	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001202 157 186 PF00397 WW/Rsp5/WWP

HMMSmart IPR001202 156 188 SM00456 WW/Rsp5/WWP

ProfileScan IPR001202 161 188 PS50020 WW/Rsp5/WWP

ScanRegExp IPR001202 161 186 PS01159 WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	157	186	PF00397	WW/Rsp5/WWP
HMMSmart	IPR001202	156	188	SM00456	WW/Rsp5/WWP
ProfileScan	IPR001202	161	188	PS50020	WW/Rsp5/WWP
ScanRegExp	IPR001202	161	186	PS01159	WW/Rsp5/WWP

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1380 bp
Genome contig ID	gi65551972f_7812135
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TATATTAAAATAAAAAAAGAAACGATTGCTACTAT
Flanking genome sequence (157957 - 158006)	----+--------+--------+--------+--------+----* AAAGCTACCTTGGCTTTTTTTTTTTTAACCCGTTTGCTTAAAAATTTTAG

Gene/Protein Characteristic Table for mKIAA1844

Features of the cloned DNA sequence

Features of the protein sequence