KIAA1844

Product ID	ORK07345
Accession No	AB058747
Description	WW domain containing adaptor with coiled-coil
Clone name	fj12009
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4526 bp) Predicted protein sequence (367 aa)
Source	Human fetal brain
Rouge ID	mKIAA1844 by Kazusa Mouse cDNA Project

Length: 4526 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3420 bp
Genome contig ID	gi89161187f_28764621
PolyA signal sequence (None)	+--------+--------+----*----+---- TTACATGTAAACCTGTCTGCAAAATTAGCTTTTTT
Flanking genome sequence (184276 - 184325)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAATTGGGGGGGTTAATTTATCATTCAGAAATCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	28864621	28948895	10	100.0	Perfect prediction

Length: 367 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW86036	3.8e-107	100.0	WW domain conta...	Homo sapiens
CAD28517	5.2e-104	98.4	hypothetical pr...	Homo sapiens
CAH70768	1.8e-103	99.2	WW domain conta...	Homo sapiens
Q9BTA9	1.9e-103	99.2	WW domain-conta...	Homo sapiens
BAD97320	1.9e-103	99.2	WW domain-conta...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	63	92	PF00397	WW/Rsp5/WWP
HMMSmart	IPR001202	62	94	SM00456	WW/Rsp5/WWP
ProfileScan	IPR001202	67	94	PS50020	WW/Rsp5/WWP
ScanRegExp	IPR001202	67	92	PS01159	WW/Rsp5/WWP

Primer_f	CTGTAAATCTGTTGCCCAATC
Primer_r	CGTGAAGGATACATCTACAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-