ROUGE

Gene/Protein Characteristic Table for mKIAA1821

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122559
Description :	Rab11-FIP4-like.
Clone Name :	mbg06507 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6001 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5193 bp

Genome contig ID gi65527427f_79312212
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CACAGTGTAAATAAAAAGTTGGCTTTTTGTGCCTG
Flanking genome sequence
(111472 - 111521)
----+----*----+----*----+----*----+----*----+----*
ACTTGTGTGAACTTCTGTGGGGGACTGGGAGAGGGAATGGAGGTGATGCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1821 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1821	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..808
Length: 268 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BQP8	1.2e-75	100.0	Rab11 family-in...	Mus musculus
EDM05395	2.1e-75	99.6	rCG34082 [Rattu...	Rattus norvegicus
XP_001504084	1.6e-72	96.5	RAB11 family in...	Equus caballus
CAD38543	4.4e-72	95.8	hypothetical pr...	Homo sapiens
XP_001109342	5.6e-72	95.8	similar to RAB1...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093257	2e-23	56.1	mKIAA0665

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5193 bp
Genome contig ID	gi65527427f_79312212
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CACAGTGTAAATAAAAAGTTGGCTTTTTGTGCCTG
Flanking genome sequence (111472 - 111521)	----+--------+--------+--------+--------+----* ACTTGTGTGAACTTCTGTGGGGGACTGGGAGAGGGAATGGAGGTGATGCA

Gene/Protein Characteristic Table for mKIAA1821

Features of the cloned DNA sequence

Features of the protein sequence