| ROUGE |
Gene/Protein Characteristic Table for mKIAA1821 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK122559 |
|---|---|
| Rab11-FIP4-like. | |
| mbg06507 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6001 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5193 bp Genome contig ID gi65527427f_79312212 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
CACAGTGTAAATAAAAAGTTGGCTTTTTGTGCCTGFlanking genome sequence
(111472 - 111521) ----+----*----+----*----+----*----+----*----+----*
ACTTGTGTGAACTTCTGTGGGGGACTGGGAGAGGGAATGGAGGTGATGCA
KIAA Alignment based on: KIAA1821 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..808
Length: 268 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |