ROUGE

Gene/Protein Characteristic Table for mKIAA0665

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093257
Description :
Clone Name :	mbg06337 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4451 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1731 bp

Genome contig ID gi65550231r_23682212
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
GTGTCAGCTACCACAGATTAAAGCTGTTACCGCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACGGAGCCGGCTTCTTTCTCCACAGGGTGGTGGGGTGGGTGGCTATGGGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0665 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0665	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2720
Length: 905 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001062691	0	92.6	similar to Rab1...	Rattus norvegicus
CAQ11003	9.6e-164	86.7	RAB11 family in...	Homo sapiens
EDL22483	7.7e-146	100.0	mCG132822, isof...	Mus musculus
BAG57098	1.6e-130	89.6	unnamed protein...	Homo sapiens
AAH81997	2e-94	89.4	Rab11fip3 prote...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122559	2.7e-22	56.1	mKIAA1821

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002048 313 341 PF00036 Calcium-binding EF-hand

ProfileScan IPR002048 305 370 PS50222 Calcium-binding EF-hand

NULL 594 815 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002048	313	341	PF00036	Calcium-binding EF-hand
ProfileScan	IPR002048	305	370	PS50222	Calcium-binding EF-hand
NULL	594	815	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1731 bp
Genome contig ID	gi65550231r_23682212
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GTGTCAGCTACCACAGATTAAAGCTGTTACCGCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGGAGCCGGCTTCTTTCTCCACAGGGTGGTGGGGTGGGTGGCTATGGGC

Gene/Protein Characteristic Table for mKIAA0665

Features of the cloned DNA sequence

Features of the protein sequence