Order Kazusa clone(s) from : ![]() |
Product ID | ORK06553 |
---|---|
Accession No | AB058724 |
Description | RAB11 family interacting protein 4 (class II) |
Clone name | fh12913 |
Vector information | |
cDNA sequence | DNA sequence (5363 bp) Predicted protein sequence (609 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1821
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3531 bp |
---|---|
Genome contig ID | gi51511734f_26643079 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (243324 - 243373) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 26743079 | 26886401 | 15 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR002048 | 21 | 56 | PS50222 | Calcium-binding EF-hand |
![]() |
Primer_f | TTTCAGAATCCTAGCTCCGGG |
---|---|
Primer_r | TCAGAAGGATGGAAGACTAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |