ROUGE |
Gene/Protein Characteristic Table for mKIAA1665 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC010793 |
---|---|
DNA-directed RNA polymerase III subunit 22.9 kDa polypeptide. | |
mie39080 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 877 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 528 bp Genome contig ID gi65543215r_81866802 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
CGCAGAATACATTTAATAAATACTGGTGGCAGAGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGGAACCTCCCCTTTTCATTAGCTGACATCACCATCTAAGGTCACTGAAT
KIAA Alignment based on: KIAA1665 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..349
Length: 115 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |