ROUGE |
Gene/Protein Characteristic Table for mKIAA1662 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129417 |
---|---|
TRIO and F-actin binding protein (Fragment). | |
mfk00026 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3978 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 663 bp Genome contig ID gi65543215f_78934393 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
CCGTGAGTCACCCTAACTTAATAAAACCTTCCGGCFlanking genome sequence
(122758 - 122807) ----+----*----+----*----+----*----+----*----+----*
AACTCTGGCTCTGTGGATGCTGGGCTTCCAGGGTAGGGAGTGGGAATCGG
KIAA Alignment based on: KIAA1662 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..442, 1906..3315
Length: 616 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |