KIAA1662

Product ID	ORK07209
Accession No	AB051449
Description	TRIO and F-actin binding protein
Clone name	fj03879s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5562 bp) Predicted protein sequence (1653 aa)
Source	Human fetal brain
Rouge ID	mKIAA1662 by Kazusa Mouse cDNA Project
Note	We replaced fj03879, former representative clones for KIAA1662 with fj03879s1. (2002/5/10)

Length: 5562 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	345 bp
Genome contig ID	gi89161203f_36350666
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTTTTCCTTTTTTTCCAAAACACTTTATACTTT
Flanking genome sequence (149412 - 149461)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGCAATTCCTGGTGGCTGTGTGCCTCCAACCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	36450661	36500076	18	99.2	Terminal No-hit

Length: 1653 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ABB59559	0	99.8	TRIOBP isoform ...	Homo sapiens
Q9H2D6	0	99.8	TRIO and F-acti...	Homo sapiens
XP_515120	0	98.3	TRIO and F-acti...	Pan troglodytes
EAW60185	0	99.8	TRIO and F-acti...	Homo sapiens
XP_001916851	5.8e-214	81.9	TRIO and F-acti...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020671	3.2e-13	45.5	KIAA0864

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	1067	1175	PF00169	Pleckstrin-like
HMMSmart	IPR001849	1067	1177	SM00233	Pleckstrin-like
ProfileScan	IPR001849	1066	1175	PS50003	Pleckstrin-like

Primer_f	TCGCAGTGGAAGAAACATTGG
Primer_r	GACAAGGTATAGACAGCATCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-