Order Kazusa clone(s) from : ![]() |
Product ID | ORK07209 |
---|---|
Accession No | AB051449 |
Description | TRIO and F-actin binding protein |
Clone name | fj03879s1 |
Vector information | |
cDNA sequence | DNA sequence (5562 bp) Predicted protein sequence (1653 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1662
by Kazusa Mouse cDNA Project
|
Note | We replaced fj03879, former representative clones for KIAA1662 with fj03879s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 345 bp |
---|---|
Genome contig ID | gi89161203f_36350666 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (149412 - 149461) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | f | 36450661 | 36500076 | 18 | 99.2 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TCGCAGTGGAAGAAACATTGG |
---|---|
Primer_r | GACAAGGTATAGACAGCATCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |