ROUGE |
Gene/Protein Characteristic Table for mKIAA1645 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173227 |
---|---|
Guanine nucleotide-binding protein beta subunit-like protein 1. | |
mfj18213 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3549 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2393 bp Genome contig ID gi65546577f_17169939 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
CCTAAAAGTTACCCCAATAAAGTCATTGGTTCACTFlanking genome sequence
(167793 - 167842) ----+----*----+----*----+----*----+----*----+----*
ACGCTAGACTTGATTTGTCCAGGGGACTGTCATCAGTGCCTTATCTGGGG
KIAA Alignment based on: KIAA1645 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1156
Length: 384 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |