KIAA1645

Product ID	ORK00260
Accession No	AB051432
Description	guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Clone name	fg04139
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6645 bp) Predicted protein sequence (386 aa)
HaloTag ORF Clone	FHC00260
Flexi ORF Clone	FXC00260
Source	Human fetal brain
Rouge ID	mKIAA1645 by Kazusa Mouse cDNA Project

Length: 6645 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5483 bp
Genome contig ID	gi89161203r_18050747
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATCTCTTGCTACATTAATAAACCACCTCAAACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCAGCATAACAGCCATTCTGGGCACGTGGGCTCCGTGGGTCGGGAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	18150747	18222403	8	99.1	Perfect prediction

Length: 386 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BYB4	8.3e-124	100.0	Guanine nucleot...	Homo sapiens
XP_001166346	8.8e-122	98.5	guanine nucleot...	Pan troglodytes
XP_543544	1.8e-102	76.8	similar to guan...	Canis lupus fam...
XP_001929668	2.2e-100	83.9	similar to guan...	Sus scrofa
Q9EQ15	5.8e-97	81.5	Guanine nucleot...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001680	99	113	PR00320	WD40 repeat
	IPR001680	240	254	PR00320	WD40 repeat
	IPR001680	368	382	PR00320	WD40 repeat
HMMPfam	IPR001680	69	112	PF00400	WD40 repeat
	IPR001680	116	155	PF00400	WD40 repeat
	IPR001680	318	340	PF00400	WD40 repeat
	IPR001680	344	381	PF00400	WD40 repeat
HMMSmart	IPR001680	68	112	SM00320	WD40 repeat
	IPR001680	115	155	SM00320	WD40 repeat
	IPR001680	214	253	SM00320	WD40 repeat
	IPR001680	256	295	SM00320	WD40 repeat
	IPR001680	301	340	SM00320	WD40 repeat
	IPR001680	343	381	SM00320	WD40 repeat
ProfileScan	IPR001680	75	164	PS50294	WD40 repeat
	IPR001680	239	386	PS50294	WD40 repeat
	IPR001680	350	386	PS50082	WD40 repeat
ScanRegExp	IPR001680	240	254	PS00678	WD40 repeat

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-