ROUGE

Gene/Protein Characteristic Table for mKIAA1607

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173214
Description :
Clone Name :	msk09334 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 1437 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 369 bp

Genome contig ID gi65540054r_30996043
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
CCACTGTCTTTATTTTATTAAAACTCCATTTTCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGGAAGGCTGCTTGAGCGTTACCTTGTCTGGTTTCATCTGAATTCTTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1607 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1607	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1068
Length: 355 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE33102	1.7e-153	100.0	unnamed protein...	Mus musculus
XP_001060720	2.8e-147	94.9	similar to WD r...	Rattus norvegicus
EDL24848	5.2e-139	100.0	mCG1051040 [Mus...	Mus musculus
XP_001113742	4e-135	85.6	similar to WD r...	Macaca mulatta
AAH47574	2.3e-132	83.9	WDFY4 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093277	1.2e-47	46.3	mKIAA0993
AK129146	0.00016	27.2	mKIAA0449
AK129426	0.00039	28.4	mKIAA1708
AK131146	0.00094	27.7	mFLJ00182

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001680 119 133 PR00320 WD-40 repeat

IPR001680 168 182 PR00320 WD-40 repeat

IPR001680 258 272 PR00320 WD-40 repeat

HMMPfam IPR001680 94 132 PF00400 WD-40 repeat

IPR001680 144 181 PF00400 WD-40 repeat

IPR001680 186 222 PF00400 WD-40 repeat

IPR001680 229 271 PF00400 WD-40 repeat

HMMSmart IPR001680 92 132 SM00320 WD-40 repeat

IPR001680 142 181 SM00320 WD-40 repeat

IPR001680 184 222 SM00320 WD-40 repeat

IPR001680 224 271 SM00320 WD-40 repeat

IPR001680 317 352 SM00320 WD-40 repeat

ProfileScan IPR001680 149 183 PS50082 WD-40 repeat

IPR001680 149 280 PS50294 WD-40 repeat

ScanRegExp IPR001680 168 182 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001680	119	133	PR00320	WD-40 repeat
IPR001680	168	182	PR00320	WD-40 repeat
IPR001680	258	272	PR00320	WD-40 repeat
HMMPfam	IPR001680	94	132	PF00400	WD-40 repeat
IPR001680	144	181	PF00400	WD-40 repeat
IPR001680	186	222	PF00400	WD-40 repeat
IPR001680	229	271	PF00400	WD-40 repeat
HMMSmart	IPR001680	92	132	SM00320	WD-40 repeat
IPR001680	142	181	SM00320	WD-40 repeat
IPR001680	184	222	SM00320	WD-40 repeat
IPR001680	224	271	SM00320	WD-40 repeat
IPR001680	317	352	SM00320	WD-40 repeat
ProfileScan	IPR001680	149	183	PS50082	WD-40 repeat
IPR001680	149	280	PS50294	WD-40 repeat
ScanRegExp	IPR001680	168	182	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	369 bp
Genome contig ID	gi65540054r_30996043
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CCACTGTCTTTATTTTATTAAAACTCCATTTTCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGGAAGGCTGCTTGAGCGTTACCTTGTCTGGTTTCATCTGAATTCTTA

Gene/Protein Characteristic Table for mKIAA1607

Features of the cloned DNA sequence

Features of the protein sequence