ROUGE |
Gene/Protein Characteristic Table for mKIAA1607 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173214 |
---|---|
msk09334 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1437 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 369 bp Genome contig ID gi65540054r_30996043 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
CCACTGTCTTTATTTTATTAAAACTCCATTTTCCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATGGAAGGCTGCTTGAGCGTTACCTTGTCTGGTTTCATCTGAATTCTTA
KIAA Alignment based on: KIAA1607 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1068
Length: 355 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001680 | 119 | 133 | PR00320 | WD-40 repeat |
IPR001680 | 168 | 182 | PR00320 | WD-40 repeat | |
IPR001680 | 258 | 272 | PR00320 | WD-40 repeat | |
HMMPfam | IPR001680 | 94 | 132 | PF00400 | WD-40 repeat |
IPR001680 | 144 | 181 | PF00400 | WD-40 repeat | |
IPR001680 | 186 | 222 | PF00400 | WD-40 repeat | |
IPR001680 | 229 | 271 | PF00400 | WD-40 repeat | |
HMMSmart | IPR001680 | 92 | 132 | SM00320 | WD-40 repeat |
IPR001680 | 142 | 181 | SM00320 | WD-40 repeat | |
IPR001680 | 184 | 222 | SM00320 | WD-40 repeat | |
IPR001680 | 224 | 271 | SM00320 | WD-40 repeat | |
IPR001680 | 317 | 352 | SM00320 | WD-40 repeat | |
ProfileScan | IPR001680 | 149 | 183 | PS50082 | WD-40 repeat |
IPR001680 | 149 | 280 | PS50294 | WD-40 repeat | |
ScanRegExp | IPR001680 | 168 | 182 | PS00678 | WD-40 repeat |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |