Order Kazusa clone(s) from : ![]() |
Product ID | ORK04305 |
---|---|
Accession No | AB046827 |
Description | WDFY family member 4 |
Clone name | fj11118 |
Vector information | |
cDNA sequence | DNA sequence (4191 bp) Predicted protein sequence (1270 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1607
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 376 bp |
---|---|
Genome contig ID | gi89161187f_49599144 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (261858 - 261907) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 49699144 | 49861000 | 29 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001680 | 1064 | 1097 | PD000018 | WD40 repeat |
FPrintScan | IPR001680 | 1034 | 1048 | PR00320 | WD40 repeat |
IPR001680 | 1083 | 1097 | PR00320 | WD40 repeat | |
IPR001680 | 1173 | 1187 | PR00320 | WD40 repeat | |
HMMPfam | IPR000409 | 625 | 907 | PF02138 | Beige/BEACH |
IPR001680 | 1058 | 1096 | PF00400 | WD40 repeat | |
IPR001680 | 1100 | 1137 | PF00400 | WD40 repeat | |
IPR001680 | 1143 | 1186 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 1007 | 1047 | SM00320 | WD40 repeat |
IPR001680 | 1057 | 1096 | SM00320 | WD40 repeat | |
IPR001680 | 1099 | 1137 | SM00320 | WD40 repeat | |
IPR001680 | 1139 | 1186 | SM00320 | WD40 repeat | |
IPR001680 | 1232 | 1267 | SM00320 | WD40 repeat | |
ProfileScan | IPR000409 | 613 | 907 | PS50197 | Beige/BEACH |
IPR001680 | 1064 | 1105 | PS50082 | WD40 repeat | |
IPR001680 | 1064 | 1195 | PS50294 | WD40 repeat | |
IPR001680 | 1170 | 1195 | PS50082 | WD40 repeat | |
ScanRegExp | IPR001680 | 1083 | 1097 | PS00678 | WD40 repeat |
![]() |
Primer_f | GTCTTCTACAACAATGATCGG |
---|---|
Primer_r | TGCTGATGTCCCTTTTCTGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | CAGAAGGATTTGGATTGGAGC |
Primer_r | GTCTGCACTGTCTTCTGGATG |
PCR product length | 145(1.6k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |