KIAA1607

Product ID	ORK04305
Accession No	AB046827
Description	WDFY family member 4
Clone name	fj11118
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4191 bp) Predicted protein sequence (1270 aa)
Source	Human fetal brain
Rouge ID	mKIAA1607 by Kazusa Mouse cDNA Project

Length: 4191 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	376 bp
Genome contig ID	gi89161187f_49599144
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GTATTGTCTTTATTTTATTAAAGCAACTATGTTTT
Flanking genome sequence (261858 - 261907)	----+--------+--------+--------+--------+----* AAATGCAGAAGGGCTCTTCAGTTTTAAACTGCCACTCTATTCCACTTACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	49699144	49861000	29	99.8	Perfect prediction

Length: 1270 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW93118	100.0	hCG1745555, iso...	Homo sapiens
Q6ZS81	99.8	Protein WDFY4.	Homo sapiens
XP_001113742	96.6	similar to WD r...	Macaca mulatta
BAB84911	98.0	FLJ00156 protei...	Homo sapiens
XP_001926773	86.3	similar to WD r...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023210	5.3e-68	38.6	KIAA0993
AB011112	5.1e-56	30.0	KIAA0540
AB046764	4e-55	38.3	KIAA1544

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	1064	1097	PD000018	WD40 repeat
FPrintScan	IPR001680	1034	1048	PR00320	WD40 repeat
	IPR001680	1083	1097	PR00320	WD40 repeat
	IPR001680	1173	1187	PR00320	WD40 repeat
HMMPfam	IPR000409	625	907	PF02138	Beige/BEACH
	IPR001680	1058	1096	PF00400	WD40 repeat
	IPR001680	1100	1137	PF00400	WD40 repeat
	IPR001680	1143	1186	PF00400	WD40 repeat
HMMSmart	IPR001680	1007	1047	SM00320	WD40 repeat
	IPR001680	1057	1096	SM00320	WD40 repeat
	IPR001680	1099	1137	SM00320	WD40 repeat
	IPR001680	1139	1186	SM00320	WD40 repeat
	IPR001680	1232	1267	SM00320	WD40 repeat
ProfileScan	IPR000409	613	907	PS50197	Beige/BEACH
	IPR001680	1064	1105	PS50082	WD40 repeat
	IPR001680	1064	1195	PS50294	WD40 repeat
	IPR001680	1170	1195	PS50082	WD40 repeat
ScanRegExp	IPR001680	1083	1097	PS00678	WD40 repeat

Primer_f	GTCTTCTACAACAATGATCGG
Primer_r	TGCTGATGTCCCTTTTCTGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CAGAAGGATTTGGATTGGAGC
Primer_r	GTCTGCACTGTCTTCTGGATG
PCR product length	145(1.6k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles