ROUGE |
Gene/Protein Characteristic Table for mKIAA0449 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129146 |
---|---|
kinesin family member 21B. N-5 kinesin. |
|
mfj00177 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4559 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4042 bp Genome contig ID gi65488608f_135918555 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TCTAAGAGCTTGTCATAAATAAAACCATTGTCCACFlanking genome sequence
(106340 - 106389) ----+----*----+----*----+----*----+----*----+----*
AGAGGTGTGGCTAGTGGGTTGGTGGCCTGTGGCTGGTAGCTCTTTCTTAG
KIAA Alignment based on: KIAA0449 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..517
Length: 171 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001680 | 5 | 19 | PR00320 | WD-40 repeat |
IPR001680 | 51 | 65 | PR00320 | WD-40 repeat | |
IPR001680 | 134 | 148 | PR00320 | WD-40 repeat | |
HMMPfam | IPR001680 | 28 | 64 | PF00400 | WD-40 repeat |
IPR001680 | 70 | 107 | PF00400 | WD-40 repeat | |
IPR001680 | 112 | 147 | PF00400 | WD-40 repeat | |
HMMSmart | IPR001680 | 26 | 64 | SM00320 | WD-40 repeat |
IPR001680 | 67 | 107 | SM00320 | WD-40 repeat | |
IPR001680 | 110 | 147 | SM00320 | WD-40 repeat | |
ProfileScan | IPR001680 | 1 | 156 | PS50294 | WD-40 repeat |
IPR001680 | 34 | 73 | PS50082 | WD-40 repeat | |
IPR001680 | 75 | 116 | PS50082 | WD-40 repeat | |
IPR001680 | 117 | 147 | PS50082 | WD-40 repeat |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |