| ROUGE |
Gene/Protein Characteristic Table for mKIAA0449 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129146 |
|---|---|
| kinesin family member 21B. N-5 kinesin. |
|
| mfj00177 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4559 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4042 bp Genome contig ID gi65488608f_135918555 PolyA signal sequence
(AATAAA,-18)
TCTAAGAGCTTGTCATAAATAAAACCATTGTCCACFlanking genome sequence
(106340 - 106389)
AGAGGTGTGGCTAGTGGGTTGGTGGCCTGTGGCTGGTAGCTCTTTCTTAG
KIAA Alignment based on: KIAA0449 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..517
Length: 171 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
