ROUGE

Gene/Protein Characteristic Table for mKIAA1495

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122516
Description :
Clone Name :	mbh04715 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4686 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2569 bp

Genome contig ID gi66880665r_140810435
PolyA signal sequence
(GATAAA,-14)
+----*----+----*----+----*----+----
ATATTACCGATGCAAACTGTGGATAAAATTGAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAATCTAAGCCTGGAACTCATTTTTTTTTTCTATTATGTTTCTCAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1495 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1495	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1311..2117
Length: 268 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAM24881	5.6e-106	99.6	leucine-rich re...	Mus musculus
AAI25225	2.1e-98	93.1	LRCH2 protein [...	Homo sapiens
EDL14707	1.7e-80	84.2	mCG67317 [Mus m...	Mus musculus
AAH56180	5.2e-67	91.7	Lrch2 protein [...	Mus musculus
CAM24882	5.4e-67	91.7	leucine-rich re...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129264	5e-36	56.2	mKIAA1016

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001715 147 259 PF00307 Calponin-like actin-binding

HMMSmart IPR001715 151 254 SM00033 Calponin-like actin-binding

ProfileScan IPR001715 145 258 PS50021 Calponin-like actin-binding

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001715	147	259	PF00307	Calponin-like actin-binding
HMMSmart	IPR001715	151	254	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	145	258	PS50021	Calponin-like actin-binding

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2569 bp
Genome contig ID	gi66880665r_140810435
PolyA signal sequence (GATAAA,-14)	+--------+--------+----*----+---- ATATTACCGATGCAAACTGTGGATAAAATTGAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAATCTAAGCCTGGAACTCATTTTTTTTTTCTATTATGTTTCTCAC

Gene/Protein Characteristic Table for mKIAA1495

Features of the cloned DNA sequence

Features of the protein sequence