ROUGE |
Gene/Protein Characteristic Table for mKIAA1480 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173182 |
---|---|
Neuroligin 3 precursor. | |
mbg07853 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5570 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1088 bp Genome contig ID gi66880665f_95797201 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
TTGATATAAAAATAAAAAATCCAGTTAGCACTCCCFlanking genome sequence
(125511 - 125560) ----+----*----+----*----+----*----+----*----+----*
AACCTGCCTCCGTTGCACAGGCCTGCCCCAACAGCCTCTGGAGCCAGGGG
KIAA Alignment based on: KIAA1480 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1852..4482
Length: 876 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |