Gene/Protein Characteristic Table for mKIAA1366

Length: 5000 bp

Restriction map

Length of 3'UTR	2078 bp
Genome contig ID	gi65527427r_69448781
PolyA signal sequence (TATAAA,-19)	+----*----+----*----+----*----+---- AAGAGAATATTGTAAATATAAAAGTTTAACTGTTG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* GTTGTGTTGTCTCCTGTCGTGTTAGAAGGTAGGTGGAGGGTGGAGAGGGT

KIAA	Alignment based on:
KIAA1366	DNA sequence, AA sequence, Physical map

Coding region: 268..2922

Length: 884 aa

Entry Exp ID% Protein Source Q62888 0 100.0 Neuroligin-2; F... Rattus norvegicus Q69ZK9 0 99.9 Neuroligin-2; F... Mus musculus XP_001254643 0 98.3 neuroligin 2 [B... Bos taurus Q8NFZ4 0 98.3 Neuroligin-2; F... Homo sapiens XP_849499 0 97.3 similar to neur... Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173182 4.3e-87 64.4 mKIAA1480 AK122433 1.2e-61 62.7 mKIAA1070

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000460	495	509	PR01090	Neuroligin
	IPR000460	598	619	PR01090	Neuroligin
	IPR000460	628	646	PR01090	Neuroligin
	IPR000460	719	748	PR01090	Neuroligin
HMMPfam	IPR002018	49	649	PF00135	Carboxylesterase
ProfileScan	NULL	36	85	PS50315	NULL
	IPR000379	226	328	PS50187	Esterase/lipase/thioesterase
	IPR000694	812	866	PS50099	Proline-rich region
ScanRegExp	IPR002018	187	197	PS00941	Carboxylesterase

Method	From	To	amino acid sequence
SOSUI	40	61	GGRGGPPISMWLLALCLVGLAG
	108	129	NEILGPVVQFLGVPYATPPLGA
	725	746	LSVTVAVGASLLFLNILAFAAL