ROUGE

Gene/Protein Characteristic Table for mKIAA1476

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173180
Description :	BROMODOMAIN ADJACENT to zinc finger domain 2B (Fragment).
Clone Name :	mfj36368 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4334 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi66880554r_59672754
PolyA signal sequence
(AAGAAA,-10)
+----*----+----*----+----*----+----
GGCATGGAAAGTGGTGAAGGCCTAGAAGAAATTGC
Flanking genome sequence
(96827 - 96778)
----+----*----+----*----+----*----+----*----+----*
AAAAGAAAAAGAAAAGCTTAAAAAGGCAGAGAGTCTCCAGATCAAAGAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1476 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1476	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 226..4332
Length: 1369 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL26954	0	97.6	bromodomain adj...	Mus musculus
AAI50815	0	97.6	Baz2b protein [...	Mus musculus
EDM00389	0	93.7	bromodomain adj...	Rattus norvegicus
CAM26914	7.6e-217	93.9	bromodomain adj...	Mus musculus
BAC27164	3e-207	93.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001739 755 833 PF01429 Methyl-CpG binding

IPR004022 1047 1109 PF02791 DDT

HMMSmart IPR001739 758 828 SM00391 Methyl-CpG binding

ProfileScan NULL 11 67 PS50324 NULL

NULL 259 283 PS50324 NULL

NULL 614 679 PS50312 NULL

NULL 624 683 PS50313 NULL

IPR004022 1047 1112 PS50827 DDT

NULL 1256 1299 PS50312 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001739	755	833	PF01429	Methyl-CpG binding
IPR004022	1047	1109	PF02791	DDT
HMMSmart	IPR001739	758	828	SM00391	Methyl-CpG binding
ProfileScan	NULL	11	67	PS50324	NULL
NULL	259	283	PS50324	NULL
NULL	614	679	PS50312	NULL
NULL	624	683	PS50313	NULL
IPR004022	1047	1112	PS50827	DDT
NULL	1256	1299	PS50312	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi66880554r_59672754
PolyA signal sequence (AAGAAA,-10)	+--------+--------+----*----+---- GGCATGGAAAGTGGTGAAGGCCTAGAAGAAATTGC
Flanking genome sequence (96827 - 96778)	----+--------+--------+--------+--------+----* AAAAGAAAAAGAAAAGCTTAAAAAGGCAGAGAGTCTCCAGATCAAAGAAG

Gene/Protein Characteristic Table for mKIAA1476

Features of the cloned DNA sequence

Features of the protein sequence