ROUGE

Gene/Protein Characteristic Table for mKIAA1451

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173174
Description :	oxysterol binding protein-like 8.
Clone Name :	mth01486 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 5313 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4023 bp

Genome contig ID gi65524842f_110797871
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AAGTAGGTATTCTAAATAAACTTTTTTAAAAGAGC
Flanking genome sequence
(122230 - 122279)
----+----*----+----*----+----*----+----*----+----*
AATCTGTGATCCAGTGACTCTTGATATAATGTATTAATGCATAATGTACT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1451 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1451	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1290
Length: 429 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL21722	1.7e-174	100.0	oxysterol bindi...	Mus musculus
EDL21721	1.8e-174	100.0	oxysterol bindi...	Mus musculus
EDM16739	5.9e-173	98.6	similar to oxys...	Rattus norvegicus
EDM16738	6.2e-173	98.6	similar to oxys...	Rattus norvegicus
EAW97327	3.8e-170	96.7	oxysterol bindi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129385	2.8e-36	44.8	mKIAA1534
AK220257	9.6e-09	26.7	mKIAA0772
AK220498	1e-08	26.1	mKIAA4128
AK220301	4.7e-08	26.0	mKIAA4220

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000648 1 325 PF01237 Oxysterol-binding protein

ScanRegExp IPR000648 50 60 PS01013 Oxysterol-binding protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000648	1	325	PF01237	Oxysterol-binding protein
ScanRegExp	IPR000648	50	60	PS01013	Oxysterol-binding protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 409 429 KDYFVIFLLILLQVIINFIFK

Method	From	To	amino acid sequence
SOSUI	409	429	KDYFVIFLLILLQVIINFIFK

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4023 bp
Genome contig ID	gi65524842f_110797871
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAGTAGGTATTCTAAATAAACTTTTTTAAAAGAGC
Flanking genome sequence (122230 - 122279)	----+--------+--------+--------+--------+----* AATCTGTGATCCAGTGACTCTTGATATAATGTATTAATGCATAATGTACT

Gene/Protein Characteristic Table for mKIAA1451

Features of the cloned DNA sequence

Features of the protein sequence