ROUGE |
Gene/Protein Characteristic Table for mKIAA1451 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173174 |
---|---|
oxysterol binding protein-like 8. | |
mth01486 [Vector Info] | |
Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5313 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4023 bp Genome contig ID gi65524842f_110797871 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
AAGTAGGTATTCTAAATAAACTTTTTTAAAAGAGCFlanking genome sequence
(122230 - 122279) ----+----*----+----*----+----*----+----*----+----*
AATCTGTGATCCAGTGACTCTTGATATAATGTATTAATGCATAATGTACT
KIAA Alignment based on: KIAA1451 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1290
Length: 429 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |