ROUGE |
Gene/Protein Characteristic Table for mKIAA4128 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220498 |
---|---|
Oxysterol binding protein-related protein 6. | |
mbf00283 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8010 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4657 bp Genome contig ID gi66880554f_76004311 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
AAATGTTATATAATAAATGTCACACGTTGAAACTGFlanking genome sequence
(294080 - 294129) ----+----*----+----*----+----*----+----*----+----*
ATACACAACCTGGTGTGTGTTGACTGCAGATACAGTGAGACCAGCACAGA
Features of the protein sequence |
Description | |
Coding region: 345..3350
Length: 1002 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |