ROUGE |
Gene/Protein Characteristic Table for mKIAA0772 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220257 |
---|---|
Oxysterol binding protein-related protein 2. | |
mib22030 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2064 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1089 bp Genome contig ID gi66880554f_179765383 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
AAACTGCCTCTGTCATTAAAACACTTTGAAAATCCFlanking genome sequence
(114258 - 114307) ----+----*----+----*----+----*----+----*----+----*
AACATGGGTTGAAGGTTTGATTTAATAGCTGTGGAAACTAAAAACAGGTG
KIAA Alignment based on: KIAA0772 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..975
Length: 324 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000648 | 1 | 316 | PF01237 | Oxysterol-binding protein |
ScanRegExp | IPR000648 | 14 | 24 | PS01013 | Oxysterol-binding protein |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |