ROUGE |
Gene/Protein Characteristic Table for mKIAA1437 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC048152 |
---|---|
Leucine-rich repeat-containing protein 8 precursor. | |
mfj00342 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4314 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1687 bp Genome contig ID gi66880554f_30069893 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGTGTAAGGCACTGAATAAAAACGACTTAAAATATFlanking genome sequence
(144419 - 144468) ----+----*----+----*----+----*----+----*----+----*
ATTTTATATGTACGGGTACTTTGTATATATGTCTGCACCACATGTTTGCA
KIAA Alignment based on: KIAA1437 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 192..2627
Length: 811 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |