Gene/Protein Characteristic Table for mKIAA4018

Length: 3121 bp

Restriction map

Length of 3'UTR	1299 bp
Genome contig ID	gi65519420r_77471174
PolyA signal sequence (AATAAA,-22)	+----*----+----*----+----*----+---- GATTTCCCCGTGAAATAAACTCATCATGGACACTG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* GCCATAGCTTTTTAAGAATTGTTACTTTGTGTGTTCAAAATACTAGCCAA

Coding region: 2..1819

Length: 606 aa

Entry Exp ID% Protein Source AAH46591 0 100.0 Lrrc1 protein [... Mus musculus Q80VQ1 4.2e-199 100.0 Leucine-rich re... Mus musculus EDL77765 5.5e-192 95.2 similar to RIKE... Rattus norvegicus AAH79423 6.4e-192 95.0 Leucine rich re... Rattus norvegicus XP_001156152 1.3e-187 93.3 leucine rich re... Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122211 2.1e-107 62.6 mKIAA0147 AK122498 1.1e-61 44.1 mKIAA1365 AK122473 3.5e-61 40.6 mKIAA1225 BC049775 4e-23 31.8 mKIAA0862 AK220329 7.1e-17 30.4 mKIAA0231

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	258	271	PR00019	Leucine-rich repeat
	IPR001611	301	314	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	119	141	PF00560	Leucine-rich repeat
	IPR001611	142	164	PF00560	Leucine-rich repeat
	IPR001611	165	187	PF00560	Leucine-rich repeat
	IPR001611	188	210	PF00560	Leucine-rich repeat
	IPR001611	234	256	PF00560	Leucine-rich repeat
	IPR001611	257	279	PF00560	Leucine-rich repeat
	IPR001611	280	302	PF00560	Leucine-rich repeat
	IPR001611	303	325	PF00560	Leucine-rich repeat
	IPR001611	326	348	PF00560	Leucine-rich repeat
	IPR001611	349	371	PF00560	Leucine-rich repeat
	IPR001611	372	394	PF00560	Leucine-rich repeat
	IPR001611	395	417	PF00560	Leucine-rich repeat
	IPR001611	441	463	PF00560	Leucine-rich repeat
HMMSmart	NULL	117	139	SM00366	NULL
	IPR003591	118	139	SM00369	Leucine-rich repeat
	NULL	140	162	SM00366	NULL
	IPR003591	140	162	SM00369	Leucine-rich repeat
	NULL	163	185	SM00366	NULL
	IPR003591	163	186	SM00369	Leucine-rich repeat
	NULL	186	208	SM00366	NULL
	NULL	209	231	SM00366	NULL
	IPR003591	209	231	SM00369	Leucine-rich repeat
	NULL	232	254	SM00366	NULL
	IPR003591	232	254	SM00369	Leucine-rich repeat
	NULL	255	277	SM00366	NULL
	IPR003591	255	277	SM00369	Leucine-rich repeat
	NULL	278	300	SM00366	NULL
	IPR003591	278	300	SM00369	Leucine-rich repeat
	NULL	301	323	SM00366	NULL
	IPR003591	301	323	SM00369	Leucine-rich repeat
	NULL	324	346	SM00366	NULL
	IPR003591	324	346	SM00369	Leucine-rich repeat
	NULL	347	369	SM00366	NULL
	IPR003591	347	370	SM00369	Leucine-rich repeat
	NULL	370	392	SM00366	NULL
	NULL	393	415	SM00366	NULL
	IPR003591	393	416	SM00369	Leucine-rich repeat
	NULL	416	438	SM00366	NULL
	IPR003591	440	462	SM00369	Leucine-rich repeat
ProfileScan	NULL	7	73	PS50323	NULL
	IPR003591	102	171	PS50506	Leucine-rich repeat
	NULL	209	478	PS50319	NULL
	IPR003591	241	309	PS50506	Leucine-rich repeat
	IPR003591	310	378	PS50506	Leucine-rich repeat

Method	From	To	amino acid sequence
-	-	-	-