ROUGE |
Gene/Protein Characteristic Table for mKIAA1302 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122490 |
---|---|
odd Oz/ten-m homolog 4. | |
mbg04788 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5583 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1986 bp Genome contig ID gi65511124f_90815248 PolyA signal sequence
(AAGAAA,-10) +----*----+----*----+----*----+----
TAAGTGCTCTTCCTGATTCCAAAAAAAGAAAAAAGFlanking genome sequence
(134413 - 134462) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAATCCGTCACGCTGTTGCAACCGTGTGCCACAGCCTGCTCTA
KIAA Alignment based on: KIAA1302 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 1..3597
Length: 1198 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |