Gene/Protein Characteristic Table for mKIAA1127

Length: 4691 bp

Restriction map

Length of 3'UTR	373 bp
Genome contig ID	gi65527427r_35701693
PolyA signal sequence (AAGAAA,-12)	+----*----+----*----+----*----+---- TAGCCAAAAGGAAAGGAACAGAAAAGAAACAAATT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAGCAAACAAAAAGACAAAGACACCGACCATACAAACG

KIAA	Alignment based on:
KIAA1127	DNA sequence, AA sequence, Physical map

Coding region: 3557..4318

Length: 253 aa

Entry Exp ID% Protein Source BAG63642 3.4e-100 99.2 unnamed protein... Homo sapiens AAI41362 4.3e-100 100.0 Odz2 protein [M... Mus musculus CAI35083 4.4e-100 100.0 odd Oz\/ten-m h... Mus musculus CAI35084 4.4e-100 100.0 odd Oz\/ten-m h... Mus musculus CAB70774 4.4e-100 99.2 hypothetical pr... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122513 2.1e-60 62.1 mKIAA1455 AK122490 5.6e-54 54.3 mKIAA1302

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-