ROUGE |
Gene/Protein Characteristic Table for mKIAA1295 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220379 |
---|---|
Actin, cytoplasmic 1. | |
mfj39015 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4776 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4498 bp Genome contig ID gi65527427f_32218079 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TTTTCTTTTTTAAAATAATAAAATGCTTGACTGGTFlanking genome sequence None
KIAA Alignment based on: KIAA1295 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..275
Length: 91 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |