ROUGE

Gene/Protein Characteristic Table for mKIAA1232

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122474
Description :	Presynaptic protein SAP102.
Clone Name :	mbg05359 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4940 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2083 bp

Genome contig ID gi66880665f_95269085
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AGACATATATTTTTTAATAAATGATAGTTGCAATG
Flanking genome sequence
(150687 - 150736)
----+----*----+----*----+----*----+----*----+----*
AACAATGGCTCAGAGGTCTTCTTGAAGTAGTCGAGTAGGGTGGTTGGGGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1232 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1232	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 5..2857
Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM15069	100.0	discs, large ho...	Mus musculus
AAB48561	99.6	isoform of PSD-...	Rattus norvegicus
EAX05336	98.8	discs, large ho...	Homo sapiens
AAH94368	97.8	Dlgh3 protein [...	Mus musculus
Q92796	97.1	Disks large hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220189	2.2e-32	69.6	mKIAA4187
AK122211	0.00021	31.1	mKIAA0147
BC043128	0.0005	25.4	mKIAA0583
AK122349	0.00057	22.1	mKIAA0705

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 638 696 PD000066 SH3

FPrintScan IPR001452 637 647 PR00452 SH3

IPR001452 656 671 PR00452 SH3

IPR001452 673 682 PR00452 SH3

HMMPfam IPR001478 264 348 PF00595 PDZ/DHR/GLGF

IPR001478 359 443 PF00595 PDZ/DHR/GLGF

IPR001478 519 597 PF00595 PDZ/DHR/GLGF

IPR001452 637 703 PF00018 SH3

IPR011511 638 702 PF07653 Variant SH3

IPR008144 793 895 PF00625 Guanylate kinase

HMMSmart IPR001478 272 351 SM00228 PDZ/DHR/GLGF

IPR001478 367 446 SM00228 PDZ/DHR/GLGF

IPR001478 527 600 SM00228 PDZ/DHR/GLGF

IPR001452 637 703 SM00326 SH3

IPR008145 759 938 SM00072 Guanylate kinase/L-type calcium channel region

ProfileScan IPR001478 264 351 PS50106 PDZ/DHR/GLGF

IPR001478 359 446 PS50106 PDZ/DHR/GLGF

IPR001478 519 600 PS50106 PDZ/DHR/GLGF

IPR001452 634 704 PS50002 SH3

IPR008144 760 935 PS50052 Guanylate kinase

ScanRegExp IPR008144 792 809 PS00856 Guanylate kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	638	696	PD000066	SH3
FPrintScan	IPR001452	637	647	PR00452	SH3
IPR001452	656	671	PR00452	SH3
IPR001452	673	682	PR00452	SH3
HMMPfam	IPR001478	264	348	PF00595	PDZ/DHR/GLGF
IPR001478	359	443	PF00595	PDZ/DHR/GLGF
IPR001478	519	597	PF00595	PDZ/DHR/GLGF
IPR001452	637	703	PF00018	SH3
IPR011511	638	702	PF07653	Variant SH3
IPR008144	793	895	PF00625	Guanylate kinase
HMMSmart	IPR001478	272	351	SM00228	PDZ/DHR/GLGF
IPR001478	367	446	SM00228	PDZ/DHR/GLGF
IPR001478	527	600	SM00228	PDZ/DHR/GLGF
IPR001452	637	703	SM00326	SH3
IPR008145	759	938	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR001478	264	351	PS50106	PDZ/DHR/GLGF
IPR001478	359	446	PS50106	PDZ/DHR/GLGF
IPR001478	519	600	PS50106	PDZ/DHR/GLGF
IPR001452	634	704	PS50002	SH3
IPR008144	760	935	PS50052	Guanylate kinase
ScanRegExp	IPR008144	792	809	PS00856	Guanylate kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2083 bp
Genome contig ID	gi66880665f_95269085
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AGACATATATTTTTTAATAAATGATAGTTGCAATG
Flanking genome sequence (150687 - 150736)	----+--------+--------+--------+--------+----* AACAATGGCTCAGAGGTCTTCTTGAAGTAGTCGAGTAGGGTGGTTGGGGC

Gene/Protein Characteristic Table for mKIAA1232

Features of the cloned DNA sequence

Features of the protein sequence