ROUGE |
Gene/Protein Characteristic Table for mKIAA1172 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173120 |
---|---|
Similar to pre-mRNA splicing SR protein rA4 (Fragment). | |
mfj66157 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4364 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 341 bp Genome contig ID gi65546577r_89286390 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
ACCATAGGGATGTTTTTAATAAACTCTATTTTCGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACAAACGTTAATGTGTGCTATTCTTCATACACTGCAGTGAGATGGAACG
KIAA Alignment based on: KIAA1172 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 421..4023
Length: 1200 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |