ROUGE

Gene/Protein Characteristic Table for mKIAA1116

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122451
Description :	RNA binding motif protein 16. CTD-binding SR-like protein rA8.
Clone Name :	mbh01058 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4738 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 647 bp

Genome contig ID gi65550231f_2977042
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGTTTTTAGATGCCAATAAAACTTACTTGTTTGAT
Flanking genome sequence
(183753 - 183802)
----+----*----+----*----+----*----+----*----+----*
AACAGTGTTCTAGGAATTGTATTTTTTTAACCTACAAATTCTTAAAACTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1116 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1116	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..4091
Length: 1362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH75621	100.0	Rbm16 protein [...	Mus musculus
AAH38363	99.9	Rbm16 protein [...	Mus musculus
EDL01641	100.0	mCG121289, isof...	Mus musculus
AAC52656	96.7	rA8.	Rattus norvegicus
EDL01640	96.2	mCG121289, isof...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173120	2.6e-24	37.2	mKIAA1172

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006903 150 218 PF04818 Protein of unknown function DUF618

IPR000504 573 640 PF00076 RNA-binding region RNP-1 (RNA recognition motif)

HMMSmart IPR000504 572 641 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

ProfileScan NULL 287 465 PS50322 NULL

NULL 491 553 PS50323 NULL

IPR000504 571 645 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

IPR000694 729 1094 PS50099 Proline-rich region

NULL 1106 1273 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006903	150	218	PF04818	Protein of unknown function DUF618
IPR000504	573	640	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
HMMSmart	IPR000504	572	641	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	NULL	287	465	PS50322	NULL
NULL	491	553	PS50323	NULL
IPR000504	571	645	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
IPR000694	729	1094	PS50099	Proline-rich region
NULL	1106	1273	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	647 bp
Genome contig ID	gi65550231f_2977042
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTTTTTAGATGCCAATAAAACTTACTTGTTTGAT
Flanking genome sequence (183753 - 183802)	----+--------+--------+--------+--------+----* AACAGTGTTCTAGGAATTGTATTTTTTTAACCTACAAATTCTTAAAACTG

Gene/Protein Characteristic Table for mKIAA1116

Features of the cloned DNA sequence

Features of the protein sequence