ROUGE |
Gene/Protein Characteristic Table for mKIAA1140 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK040578 |
---|---|
Tetratricopeptide repeat protein 7A. | |
mfj22197 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4481 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1699 bp Genome contig ID gi65550231f_85039870 PolyA signal sequence
(AATAAA,-33) +----*----+----*----+----*----+----
TGAATAAAAGACCCTTGGAGGGGGACAAGACTGTCFlanking genome sequence
(198706 - 198755) ----+----*----+----*----+----*----+----*----+----*
TGAAGAGTGTCCAGTTACTTGATGCTCAGCATAGAGCAGTGACCCGGGCC
KIAA Alignment based on: KIAA1140 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..2782
Length: 926 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |