ROUGE |
Gene/Protein Characteristic Table for mKIAA1099 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129289 |
---|---|
centaurin, gamma 2. | |
mfj15083 [Vector Info] | |
Source : | Mouse fetal brain |
Note : | We replaced mtj01160, former representative clones for mKIAA1099 with mfj15083. (2005/2/23) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4021 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 881 bp Genome contig ID gi65488608f_89173397 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
TAAGTAAATAAAGAGTCACTTGGAAATTCTAAACGFlanking genome sequence
(534931 - 534980) ----+----*----+----*----+----*----+----*----+----*
AAATCATGAATTCGGCTGAAAACAGCTTTCAAATATGTTCCAAAACTAAA
KIAA Alignment based on: KIAA1099 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 195..3140
Length: 981 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |