ROUGE |
Gene/Protein Characteristic Table for mKIAA1249 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122477 |
---|---|
130-kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase- activating protein. | |
mbg09359 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4148 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 906 bp Genome contig ID gi65543215r_64004341 PolyA signal sequence
(ATTAAA,-25) +----*----+----*----+----*----+----
CTTGATTGCCATTAAAGCAGAAGTTACAAGATTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACAATGCTTGTTTCTGGTCACTCATTTGGCCTTTTCCACAGTGTTTGCA
KIAA Alignment based on: KIAA1249 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..3242
Length: 1079 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 1022 | 1074 | PD000066 | SH3 |
FPrintScan | IPR001164 | 398 | 417 | PR00405 | Arf GTPase activating protein |
IPR001164 | 417 | 434 | PR00405 | Arf GTPase activating protein | |
IPR001164 | 438 | 459 | PR00405 | Arf GTPase activating protein | |
IPR001452 | 1034 | 1049 | PR00452 | SH3 | |
IPR001452 | 1051 | 1060 | PR00452 | SH3 | |
IPR001452 | 1065 | 1077 | PR00452 | SH3 | |
HMMPfam | IPR001849 | 272 | 363 | PF00169 | Pleckstrin-like |
IPR001164 | 386 | 509 | PF01412 | Arf GTPase activating protein | |
IPR002110 | 547 | 582 | PF00023 | Ankyrin | |
IPR002110 | 583 | 615 | PF00023 | Ankyrin | |
IPR001452 | 1020 | 1077 | PF00018 | SH3 | |
IPR011511 | 1021 | 1077 | PF07653 | Variant SH3 | |
HMMSmart | IPR001849 | 272 | 365 | SM00233 | Pleckstrin-like |
IPR001164 | 386 | 509 | SM00105 | Arf GTPase activating protein | |
IPR002110 | 547 | 579 | SM00248 | Ankyrin | |
IPR002110 | 583 | 612 | SM00248 | Ankyrin | |
IPR001452 | 1020 | 1078 | SM00326 | SH3 | |
ProfileScan | IPR001849 | 271 | 363 | PS50003 | Pleckstrin-like |
IPR001164 | 386 | 509 | PS50115 | Arf GTPase activating protein | |
IPR002110 | 547 | 582 | PS50088 | Ankyrin | |
IPR002110 | 547 | 624 | PS50297 | Ankyrin | |
IPR002110 | 583 | 615 | PS50088 | Ankyrin | |
IPR000694 | 730 | 943 | PS50099 | Proline-rich region | |
IPR001452 | 1017 | 1079 | PS50002 | SH3 |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |