ROUGE

Gene/Protein Characteristic Table for mKIAA1249

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122477
Description :	130-kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase- activating protein.
Clone Name :	mbg09359 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4148 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 906 bp

Genome contig ID gi65543215r_64004341
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
CTTGATTGCCATTAAAGCAGAAGTTACAAGATTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACAATGCTTGTTTCTGGTCACTCATTTGGCCTTTTCCACAGTGTTTGCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1249 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1249	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3242
Length: 1079 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH48818	99.6	Asap1 protein [...	Mus musculus
XP_001155932	96.1	development and...	Pan troglodytes
XP_001155988	95.8	development and...	Pan troglodytes
XP_001156050	95.8	development and...	Pan troglodytes
EAW92131	95.7	development and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172944	1.8e-69	53.8	mKIAA0400
AK129041	5.4e-08	28.8	mKIAA0041
AK129289	1.3e-05	30.6	mKIAA1099
AK220325	3.7e-05	29.4	mKIAA0167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 1022 1074 PD000066 SH3

FPrintScan IPR001164 398 417 PR00405 Arf GTPase activating protein

IPR001164 417 434 PR00405 Arf GTPase activating protein

IPR001164 438 459 PR00405 Arf GTPase activating protein

IPR001452 1034 1049 PR00452 SH3

IPR001452 1051 1060 PR00452 SH3

IPR001452 1065 1077 PR00452 SH3

HMMPfam IPR001849 272 363 PF00169 Pleckstrin-like

IPR001164 386 509 PF01412 Arf GTPase activating protein

IPR002110 547 582 PF00023 Ankyrin

IPR002110 583 615 PF00023 Ankyrin

IPR001452 1020 1077 PF00018 SH3

IPR011511 1021 1077 PF07653 Variant SH3

HMMSmart IPR001849 272 365 SM00233 Pleckstrin-like

IPR001164 386 509 SM00105 Arf GTPase activating protein

IPR002110 547 579 SM00248 Ankyrin

IPR002110 583 612 SM00248 Ankyrin

IPR001452 1020 1078 SM00326 SH3

ProfileScan IPR001849 271 363 PS50003 Pleckstrin-like

IPR001164 386 509 PS50115 Arf GTPase activating protein

IPR002110 547 582 PS50088 Ankyrin

IPR002110 547 624 PS50297 Ankyrin

IPR002110 583 615 PS50088 Ankyrin

IPR000694 730 943 PS50099 Proline-rich region

IPR001452 1017 1079 PS50002 SH3

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	1022	1074	PD000066	SH3
FPrintScan	IPR001164	398	417	PR00405	Arf GTPase activating protein
IPR001164	417	434	PR00405	Arf GTPase activating protein
IPR001164	438	459	PR00405	Arf GTPase activating protein
IPR001452	1034	1049	PR00452	SH3
IPR001452	1051	1060	PR00452	SH3
IPR001452	1065	1077	PR00452	SH3
HMMPfam	IPR001849	272	363	PF00169	Pleckstrin-like
IPR001164	386	509	PF01412	Arf GTPase activating protein
IPR002110	547	582	PF00023	Ankyrin
IPR002110	583	615	PF00023	Ankyrin
IPR001452	1020	1077	PF00018	SH3
IPR011511	1021	1077	PF07653	Variant SH3
HMMSmart	IPR001849	272	365	SM00233	Pleckstrin-like
IPR001164	386	509	SM00105	Arf GTPase activating protein
IPR002110	547	579	SM00248	Ankyrin
IPR002110	583	612	SM00248	Ankyrin
IPR001452	1020	1078	SM00326	SH3
ProfileScan	IPR001849	271	363	PS50003	Pleckstrin-like
IPR001164	386	509	PS50115	Arf GTPase activating protein
IPR002110	547	582	PS50088	Ankyrin
IPR002110	547	624	PS50297	Ankyrin
IPR002110	583	615	PS50088	Ankyrin
IPR000694	730	943	PS50099	Proline-rich region
IPR001452	1017	1079	PS50002	SH3

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	906 bp
Genome contig ID	gi65543215r_64004341
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- CTTGATTGCCATTAAAGCAGAAGTTACAAGATTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAATGCTTGTTTCTGGTCACTCATTTGGCCTTTTCCACAGTGTTTGCA

Gene/Protein Characteristic Table for mKIAA1249

Features of the cloned DNA sequence

Features of the protein sequence