ROUGE

Gene/Protein Characteristic Table for mKIAA1084

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129283
Description :
Clone Name :	mpf00327 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6646 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3603 bp

Genome contig ID gi65511124r_30835200
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TAAATATTGTATTTTGGTAATAAATTTTTTTTGTT
Flanking genome sequence
(99989 - 99940)
----+----*----+----*----+----*----+----*----+----*
AAAAAACCACTTGTTTCTAAGTTTCCTTAGCTGTCTGCGTGTATTCCTGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1084 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1084	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3043
Length: 1013 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL03005	99.8	mCG51010, isofo...	Mus musculus
Q6ZPY5	99.9	Zinc finger pro...	Mus musculus
AAH50041	99.7	Zfp507 protein ...	Mus musculus
EDM07606	94.5	zinc finger pro...	Rattus norvegicus
AAI36418	79.1	ZNF507 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173164	1.3e-09	26.6	mKIAA1396
AK220544	1.6e-09	27.7	mKIAA4205
BC050933	2.2e-09	27.4	mKIAA0441
AK030030	2.8e-09	23.5	mKIAA1588
AK220562	3.6e-09	24.9	mKIAA4236

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 702 724 PF00096 Zinc finger

IPR007087 730 752 PF00096 Zinc finger

IPR007087 758 781 PF00096 Zinc finger

IPR007087 818 840 PF00096 Zinc finger

IPR007087 846 868 PF00096 Zinc finger

IPR007087 971 993 PF00096 Zinc finger

HMMSmart IPR007087 194 216 SM00355 Zinc finger

IPR007087 224 247 SM00355 Zinc finger

IPR007087 309 331 SM00355 Zinc finger

IPR007087 702 724 SM00355 Zinc finger

IPR007087 730 752 SM00355 Zinc finger

IPR007087 758 781 SM00355 Zinc finger

IPR007087 818 840 SM00355 Zinc finger

IPR007087 846 868 SM00355 Zinc finger

IPR007087 971 993 SM00355 Zinc finger

ProfileScan IPR007087 702 729 PS50157 Zinc finger

IPR007087 758 786 PS50157 Zinc finger

IPR007087 818 845 PS50157 Zinc finger

IPR007087 846 873 PS50157 Zinc finger

IPR007087 971 996 PS50157 Zinc finger

ScanRegExp IPR007087 311 331 PS00028 Zinc finger

IPR007087 760 781 PS00028 Zinc finger

IPR007087 848 868 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	702	724	PF00096	Zinc finger
IPR007087	730	752	PF00096	Zinc finger
IPR007087	758	781	PF00096	Zinc finger
IPR007087	818	840	PF00096	Zinc finger
IPR007087	846	868	PF00096	Zinc finger
IPR007087	971	993	PF00096	Zinc finger
HMMSmart	IPR007087	194	216	SM00355	Zinc finger
IPR007087	224	247	SM00355	Zinc finger
IPR007087	309	331	SM00355	Zinc finger
IPR007087	702	724	SM00355	Zinc finger
IPR007087	730	752	SM00355	Zinc finger
IPR007087	758	781	SM00355	Zinc finger
IPR007087	818	840	SM00355	Zinc finger
IPR007087	846	868	SM00355	Zinc finger
IPR007087	971	993	SM00355	Zinc finger
ProfileScan	IPR007087	702	729	PS50157	Zinc finger
IPR007087	758	786	PS50157	Zinc finger
IPR007087	818	845	PS50157	Zinc finger
IPR007087	846	873	PS50157	Zinc finger
IPR007087	971	996	PS50157	Zinc finger
ScanRegExp	IPR007087	311	331	PS00028	Zinc finger
IPR007087	760	781	PS00028	Zinc finger
IPR007087	848	868	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3603 bp
Genome contig ID	gi65511124r_30835200
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TAAATATTGTATTTTGGTAATAAATTTTTTTTGTT
Flanking genome sequence (99989 - 99940)	----+--------+--------+--------+--------+----* AAAAAACCACTTGTTTCTAAGTTTCCTTAGCTGTCTGCGTGTATTCCTGT

Gene/Protein Characteristic Table for mKIAA1084

Features of the cloned DNA sequence

Features of the protein sequence