ROUGE |
Gene/Protein Characteristic Table for mKIAA1041 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129271 |
---|---|
Forkhead box protein J3. | |
mpm07344 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4645 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2700 bp Genome contig ID gi65493515f_118398628 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
GATGGCACTTAAAATAAATATATTATGATAACTGTFlanking genome sequence
(189398 - 189447) ----+----*----+----*----+----*----+----*----+----*
ATTTGCAGCCTGATGGTCTGTGTTATTTGCTGCTTGAGGAAGCCAGATTG
KIAA Alignment based on: KIAA1041 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 158..1945
Length: 595 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |