ROUGE |
Gene/Protein Characteristic Table for mKIAA1021 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173088 |
---|---|
Potential phospholipid-transporting ATPase IH. | |
mpm09008 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4028 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 193 bp Genome contig ID gi65515060f_12035705 PolyA signal sequence
(GATAAA,-9) +----*----+----*----+----*----+----
ATCATCTGAAATAAGAAGAGAACAAAGATAAATAGFlanking genome sequence
(202653 - 202702) ----+----*----+----*----+----*----+----*----+----*
AAAAAATAAGTTATTTTCTGTAACTCACAAAAAAAGTAATTGTTCCTTTG
KIAA Alignment based on: KIAA1021 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 3..1118, 1325..3796
Length: 1196 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |