ROUGE

Gene/Protein Characteristic Table for mKIAA0986

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220362
Description :	CHOREA-ACANTHOCYTOSIS homolog.
Clone Name :	mbp09156 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2808 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 41 bp

Genome contig ID gi65553144r_15759633
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAATGCATGACTTTGCAAGTGAAAGCCAACAGTA
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GATTTTAGTGTTAAACTTTTACAAACTCTGTGCAGCTGTTTCAGTATTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0986 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0986	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2767
Length: 921 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC26546	99.7	unnamed protein...	Mus musculus
AAH62130	100.0	Vps13a protein ...	Mus musculus
Q5H8C4	100.0	Vacuolar protei...	Mus musculus
NP_001094445	96.3	vacuolar protei...	Rattus norvegicus
CAF25186	90.0	chorein 1D [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129486	1.1e-142	49.9	mKIAA3021
AK122302	4.1e-13	24.0	mKIAA0532
AK172952	3.1e-11	20.7	mKIAA0453

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009543 44 321 PF06650 Vacuolar protein sorting-associated protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009543	44	321	PF06650	Vacuolar protein sorting-associated protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	41 bp
Genome contig ID	gi65553144r_15759633
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAATGCATGACTTTGCAAGTGAAAGCCAACAGTA
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GATTTTAGTGTTAAACTTTTACAAACTCTGTGCAGCTGTTTCAGTATTTT

Gene/Protein Characteristic Table for mKIAA0986

Features of the cloned DNA sequence

Features of the protein sequence