KIAA0986

Product ID	ORK07338
Accession No	AB023203
Description	vacuolar protein sorting 13 homolog A (S. cerevisiae)
Clone name	hj08124
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4779 bp) Predicted protein sequence (1458 aa)
Source	Human adult brain
Rouge ID	mKIAA0986 by Kazusa Mouse cDNA Project

Length: 4779 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	400 bp
Genome contig ID	gi89161216f_79022388
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAATTTTCTGGGCTTTAATGTAATGCCACTGTGT
Flanking genome sequence (167433 - 167482)	----+--------+--------+--------+--------+----* AAAAAAAAAGGAAGAAAATAGTAATAGCCATTTAATGTTTTATATTTATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	79122388	79189819	30	99.9	Perfect prediction

Length: 1458 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB59128	100.0	chorein [Homo s...	Homo sapiens
XP_520084	99.4	vacuolar protei...	Pan troglodytes
CAE75581	99.2	chorein 2A [Hom...	Homo sapiens
AAK61861	99.2	chorea-acanthoc...	Homo sapiens
Q96RL7	99.2	Vacuolar protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011104	3.9e-12	28.5	KIAA0532
AB007922	7.9e-11	21.2	KIAA0453

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009543	554	831	PF06650	Vacuolar protein sorting-associated protein

Primer_f	AGCCATGAATAAGCAACCAGC
Primer_r	GTCTATGATGCCTCCAGTTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-