ROUGE |
Gene/Protein Characteristic Table for mKIAA0964 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122408 |
---|---|
discs, large homolog-associated protein 4. WW domain-binding protein 16. PSD-95/SAP90 binding protein 4. SAP90/PSD-95-associated protein 4. |
|
mbg00056 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6246 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3750 bp Genome contig ID gi66880554f_155970788 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GTCCCTCCGAGCTTTAGGTTATGAAGACTTGACTCFlanking genome sequence
(249276 - 249325) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAATTAAAAAAAATTAAAAACCACACTCTAGAACCTTTTC
KIAA Alignment based on: KIAA0964 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 373..2430, 5155..6057
Length: 986 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |