ROUGE

Gene/Protein Characteristic Table for mKIAA0008

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129032
Description :	discs large homolog 7. hepatoma up-regulated protein. EST C77459.
Clone Name :	mph01047 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3247 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 924 bp

Genome contig ID gi65540054r_42374468
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TCTTCATTTGATTGATTAAAGCTTTGCCCACTTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACAACCCTTGATCAAAACAATGTTCTTTTAAAATCATTTCTTTTATTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0008 DNA sequence

KIAA	Alignment based on:
KIAA0008	DNA sequence

Features of the protein sequence	Description

Coding region: 2..2323
Length: 773 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL20748	99.5	discs, large ho...	Mus musculus
EDL20746	99.5	discs, large ho...	Mus musculus
Q8K4R9	99.6	Disks large-ass...	Mus musculus
BAB97377	99.5	hepatoma up-reg...	Mus musculus
BAE28249	98.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122408	1e-09	25.0	mKIAA0964
AK220515	2.3e-07	30.7	mKIAA4162

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005026 317 590 PF03359 Guanylate-kinase-associated protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005026	317	590	PF03359	Guanylate-kinase-associated protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	924 bp
Genome contig ID	gi65540054r_42374468
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TCTTCATTTGATTGATTAAAGCTTTGCCCACTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAACCCTTGATCAAAACAATGTTCTTTTAAAATCATTTCTTTTATTTT

Gene/Protein Characteristic Table for mKIAA0008

Features of the cloned DNA sequence

Features of the protein sequence