ROUGE

Gene/Protein Characteristic Table for mKIAA4162

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220515
Description :	Disks large-associated protein 1 (Fragment).
Clone Name :	mbg04507 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5484 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1490 bp

Genome contig ID gi65550231f_67643674
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCTGGCAACCTAAAGAATTAGAAATTTGTCATAGG
Flanking genome sequence
(947774 - 947823)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAACGAAAGACTTAAAAGAAAAAAAAAATGCTTGTAT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1022..3991
Length: 990 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE27919	99.9	unnamed protein...	Mus musculus
O14490	95.3	Disks large-ass...	Homo sapiens
XP_001915495	95.2	similar to Disk...	Equus caballus
XP_604806	94.6	similar to Disk...	Bos taurus
XP_857687	94.4	similar to Disk...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122408	2.8e-47	45.8	mKIAA0964
AK129032	4.7e-07	30.7	mKIAA0008

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005026 651 990 PF03359 Guanylate-kinase-associated protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005026	651	990	PF03359	Guanylate-kinase-associated protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1490 bp
Genome contig ID	gi65550231f_67643674
PolyA signal sequence (None)	+--------+--------+----*----+---- GCTGGCAACCTAAAGAATTAGAAATTTGTCATAGG
Flanking genome sequence (947774 - 947823)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAACGAAAGACTTAAAAGAAAAAAAAAATGCTTGTAT

Gene/Protein Characteristic Table for mKIAA4162

Features of the cloned DNA sequence

Features of the protein sequence