ROUGE

Gene/Protein Characteristic Table for mKIAA0870

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173046
Description :
Clone Name :	mth00251 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 5182 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1271 bp

Genome contig ID gi65543215f_73441042
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTTACAACTTGTGATAATAAACCCTTTTTGTTAAT
Flanking genome sequence
(159567 - 159616)
----+----*----+----*----+----*----+----*----+----*
AAATGCTGGTTGCTTGACTTGGCTGCTATGAATGGATAGCGGGGTCTTGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0870 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0870	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 69..3911
Length: 1280 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A2RT67	99.9	DENN domain-con...	Mus musculus
XP_235398	92.8	similar to MAP-...	Rattus norvegicus
XP_001499398	80.7	similar to DENN...	Equus caballus
XP_584806	77.4	similar to DENN...	Bos taurus
EAW92217	78.4	DENN/MADD domai...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173257	1.3e-12	22.1	mKIAA1766
AJ245569	7.4e-11	25.1	mKIAA1091
AK129485	1.3e-09	23.6	mKIAA3020
AK220407	1.8e-08	26.8	mKIAA1608
AK122257	3.8e-08	23.0	mKIAA0358

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001194 193 379 PF02141 DENN

IPR005112 442 505 PF03455 dDENN

IPR001680 1024 1060 PF00400 WD-40 repeat

IPR001680 1065 1104 PF00400 WD-40 repeat

IPR001680 1240 1278 PF00400 WD-40 repeat

HMMSmart IPR001680 1021 1060 SM00320 WD-40 repeat

IPR001680 1063 1104 SM00320 WD-40 repeat

IPR001680 1238 1278 SM00320 WD-40 repeat

ProfileScan IPR001194 242 379 PS50211 DENN

IPR001680 1029 1113 PS50294 WD-40 repeat

IPR001680 1070 1113 PS50082 WD-40 repeat

ScanRegExp IPR001680 1091 1105 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001194	193	379	PF02141	DENN
IPR005112	442	505	PF03455	dDENN
IPR001680	1024	1060	PF00400	WD-40 repeat
IPR001680	1065	1104	PF00400	WD-40 repeat
IPR001680	1240	1278	PF00400	WD-40 repeat
HMMSmart	IPR001680	1021	1060	SM00320	WD-40 repeat
IPR001680	1063	1104	SM00320	WD-40 repeat
IPR001680	1238	1278	SM00320	WD-40 repeat
ProfileScan	IPR001194	242	379	PS50211	DENN
IPR001680	1029	1113	PS50294	WD-40 repeat
IPR001680	1070	1113	PS50082	WD-40 repeat
ScanRegExp	IPR001680	1091	1105	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1271 bp
Genome contig ID	gi65543215f_73441042
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTACAACTTGTGATAATAAACCCTTTTTGTTAAT
Flanking genome sequence (159567 - 159616)	----+--------+--------+--------+--------+----* AAATGCTGGTTGCTTGACTTGGCTGCTATGAATGGATAGCGGGGTCTTGA

Gene/Protein Characteristic Table for mKIAA0870

Features of the cloned DNA sequence

Features of the protein sequence